WebSep 26, 2024 · We present a teaching protocol suitable for demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of industrially relevant yeasts Saccharomyces cerevisiae and Yarrowia ... WebJan 13, 2024 · cloning into EasyClone vectors CYC1_test_rv CTCCTTCCTTTTCGGTTAGAG (Stovicek et al., 2015) verification of a gene expression cassette cloning into EasyClone vectors FW_USER_TDH3 CGTGCGAUTCATTATCAATACTCGCCATT T This study Reverse primer for …
(PDF) Expansion of EasyClone-MarkerFree toolkit for Saccharomyces ...
WebBioRun EasyClone Kit. Fast Site-Mutation. BioRun Eco31I. BioRun BsmBI. WebExpress Cloning Vectors. If your experiments require custom DNA constructs in one of these expression vectors, then GenScript's Express Cloning service (SC1691) is your best option – with an unbeatable price of $49 and only 2-day turnaround time added onto your order of custom genes through our Standard (SC1010) or Fast (SC1619) Gene ... opener for smashing pumpkins
EasyClone 2.0: expanded toolkit of integrative vectors for stable …
WebSep 16, 2015 · 33 To remove the markers from the genome, the Cre/LoxP marker recycling system can then be used. 34 However, later on, the same group 35 reported a marker-free vector suite called EasyClone ... WebMay 11, 2016 · The EasyClone method allows targeted genomic integration of up to three vectors in a single transformation event using auxotrophic … WebMar 1, 2024 · We present a teaching protocol suitable for demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of industrially relevant yeasts Saccharomyces cerevisiae and Yarrowia lipolytica, using β-carotene production as a case study. The protocol details all steps required to generate … opener of rcb